circad | circRNAs associated with diseases

hsa_circ_0005105
Gene	SEC24A	Organism	Human
Genome Locus	chr5:134022479-134023989:+	Build	hg19
Disease	Osteoarthritis (OA)	ICD-10	Polyarthrosis, unspecified (M15.9)
DBLink	Link to database	PMID	28276108
Experimental Method
Sample Type	Articular Cartilage	Comparison	cell lines with and without IL-1β stimulation
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGATATTGAAGTTACGACCACCTC Reverse GGAAGCAAATCCAGATTGTCTAAC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wu, Y, Zhang, Y, Zhang, Y, Wang, JJ (2017). CircRNA hsa_circ_0005105 upregulates NAMPT expression and promotes chondrocyte extracellular matrix degradation by sponging miR-26a. Cell Biol. Int., 41, 12:1283-1289.